ID: 949920107_949920113

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 949920107 949920113
Species Human (GRCh38) Human (GRCh38)
Location 3:8993627-8993649 3:8993646-8993668
Sequence CCCTCCACTATGGCATTCCTCTG TCTGGCAGTCTGCTTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 194} {0: 1, 1: 0, 2: 0, 3: 18, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!