ID: 949925874_949925881

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 949925874 949925881
Species Human (GRCh38) Human (GRCh38)
Location 3:9041227-9041249 3:9041270-9041292
Sequence CCAGGTTGCCTAACTTCAAGTCT GTTCCACCTCCACAAACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 187} {0: 1, 1: 0, 2: 1, 3: 20, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!