ID: 949962606_949962609

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 949962606 949962609
Species Human (GRCh38) Human (GRCh38)
Location 3:9325589-9325611 3:9325620-9325642
Sequence CCTAAATCCTGGGAAAAGGGCCT ATGTCCTTCTAGACGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 233} {0: 1, 1: 14, 2: 32, 3: 48, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!