ID: 950008457_950008468

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 950008457 950008468
Species Human (GRCh38) Human (GRCh38)
Location 3:9705667-9705689 3:9705712-9705734
Sequence CCCTACTCACTGTTCCTCTTCCT CTGCAGAAGGTGAGGCTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 702} {0: 1, 1: 0, 2: 1, 3: 49, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!