ID: 950020561_950020563

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 950020561 950020563
Species Human (GRCh38) Human (GRCh38)
Location 3:9784548-9784570 3:9784567-9784589
Sequence CCCTTATGTGCACATATTTAAAT AAATATATTGTAAGTAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 517} {0: 1, 1: 0, 2: 1, 3: 22, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!