ID: 950023666_950023674

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 950023666 950023674
Species Human (GRCh38) Human (GRCh38)
Location 3:9806544-9806566 3:9806577-9806599
Sequence CCACCTCCAGTGGCTGTGACTGG TATACGTTATTGGTTGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 326} {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!