ID: 950030919_950030927

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 950030919 950030927
Species Human (GRCh38) Human (GRCh38)
Location 3:9852806-9852828 3:9852858-9852880
Sequence CCATACTGACTTTCTGGGGGTGG ATTGATAAGCTACTGGTGGTTGG
Strand - +
Off-target summary {0: 23, 1: 6, 2: 5, 3: 9, 4: 147} {0: 4, 1: 11, 2: 20, 3: 14, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!