ID: 950039514_950039519

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 950039514 950039519
Species Human (GRCh38) Human (GRCh38)
Location 3:9911011-9911033 3:9911024-9911046
Sequence CCGAATGCCACAGCTCGAGAGTC CTCGAGAGTCAGATGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67} {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!