ID: 950043236_950043245

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 950043236 950043245
Species Human (GRCh38) Human (GRCh38)
Location 3:9933498-9933520 3:9933522-9933544
Sequence CCAGCCCTGGATAGCTACTTCCA CCCCCGGGGACTCCCGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145} {0: 1, 1: 0, 2: 4, 3: 15, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!