ID: 950053282_950053286

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950053282 950053286
Species Human (GRCh38) Human (GRCh38)
Location 3:10007918-10007940 3:10007932-10007954
Sequence CCCCAATAAAGAACAGGACCAGG AGGACCAGGAAGCAAGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 275} {0: 2, 1: 2, 2: 9, 3: 53, 4: 409}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!