ID: 950138377_950138390

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 950138377 950138390
Species Human (GRCh38) Human (GRCh38)
Location 3:10599170-10599192 3:10599213-10599235
Sequence CCCTGCCCCTGCTGAATAACCTT CAGAACAAAATCTGGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175} {0: 1, 1: 0, 2: 1, 3: 34, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!