ID: 950150194_950150203

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 950150194 950150203
Species Human (GRCh38) Human (GRCh38)
Location 3:10680828-10680850 3:10680880-10680902
Sequence CCTGATAGAGTCTGGATGTTGTC CTCCATGTGGAGGTGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 147} {0: 1, 1: 1, 2: 6, 3: 75, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!