ID: 950226449_950226450

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 950226449 950226450
Species Human (GRCh38) Human (GRCh38)
Location 3:11238940-11238962 3:11238975-11238997
Sequence CCACTTTTTGGTGGTTATGAATA TCTGCATACAAGTTTTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 106, 3: 546, 4: 1873} {0: 1, 1: 1, 2: 24, 3: 127, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!