ID: 950256126_950256130

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 950256126 950256130
Species Human (GRCh38) Human (GRCh38)
Location 3:11507775-11507797 3:11507813-11507835
Sequence CCACACTCTAGATGTGGGAAGGA GGCAACCATTTCCTGCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 155} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!