ID: 950330387_950330397

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 950330387 950330397
Species Human (GRCh38) Human (GRCh38)
Location 3:12151823-12151845 3:12151872-12151894
Sequence CCTGACTCTCCCATTCCCCTGGC TTAACACTGTGCCTTCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 83, 4: 428} {0: 1, 1: 0, 2: 4, 3: 22, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!