ID: 950397977_950397991

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950397977 950397991
Species Human (GRCh38) Human (GRCh38)
Location 3:12748828-12748850 3:12748857-12748879
Sequence CCCACCCTTCCCACCCCAGGGAC GTCCTCTCCAGGGTTCTACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 619} {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!