ID: 950399702_950399708

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 950399702 950399708
Species Human (GRCh38) Human (GRCh38)
Location 3:12760457-12760479 3:12760475-12760497
Sequence CCCTCCTCAGGGCCTTTGCCCTG CCCTGGCTGTTCCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 124, 3: 558, 4: 1561} {0: 6, 1: 48, 2: 203, 3: 712, 4: 1959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!