ID: 950400023_950400029

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 950400023 950400029
Species Human (GRCh38) Human (GRCh38)
Location 3:12762785-12762807 3:12762826-12762848
Sequence CCTGAATCAGAAACTCCAGGAGT TTAAATAAGCCCCACTGGACTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 11, 3: 69, 4: 296} {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!