ID: 950507292_950507303

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 950507292 950507303
Species Human (GRCh38) Human (GRCh38)
Location 3:13403330-13403352 3:13403363-13403385
Sequence CCTGCTGTCTTCCCACTGTTGTC AGGGGCGAGGGAGCTCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 274} {0: 11, 1: 66, 2: 211, 3: 570, 4: 1030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!