ID: 950579370_950579374

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 950579370 950579374
Species Human (GRCh38) Human (GRCh38)
Location 3:13852535-13852557 3:13852550-13852572
Sequence CCAATCGACAGATGTGGAAACTG GGAAACTGAGGTCGCAAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 43, 3: 503, 4: 3204} {0: 1, 1: 1, 2: 10, 3: 96, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!