ID: 950579677_950579689

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950579677 950579689
Species Human (GRCh38) Human (GRCh38)
Location 3:13854038-13854060 3:13854088-13854110
Sequence CCCCCAGGACACCATCCTGGGGC ACTCACCAAGGCCACCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 329} {0: 1, 1: 0, 2: 4, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!