ID: 950583909_950583915

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 950583909 950583915
Species Human (GRCh38) Human (GRCh38)
Location 3:13879832-13879854 3:13879855-13879877
Sequence CCGGGGCCGCGGGCCGGGCTGTG CTGATCCCGCGGGCCGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 422} {0: 1, 1: 0, 2: 1, 3: 5, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!