ID: 950615422_950615424

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950615422 950615424
Species Human (GRCh38) Human (GRCh38)
Location 3:14154102-14154124 3:14154131-14154153
Sequence CCCGTTAAAATGGCTATTAACAA GAAAGTAACAAGTGTCAGTGAGG
Strand - +
Off-target summary {0: 2, 1: 70, 2: 649, 3: 2549, 4: 6753} {0: 1, 1: 1, 2: 38, 3: 267, 4: 874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!