ID: 950660964_950660968

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 950660964 950660968
Species Human (GRCh38) Human (GRCh38)
Location 3:14466799-14466821 3:14466819-14466841
Sequence CCACCGGGCCTGTGGCGGGTGTG GTGCCTGTCCACGGTGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 310} {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!