ID: 950666998_950667014

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 950666998 950667014
Species Human (GRCh38) Human (GRCh38)
Location 3:14503702-14503724 3:14503751-14503773
Sequence CCTGGCAGGCGGGTGGGCGGGCT AGGGCCCAGCGTTGGGCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 55, 4: 307} {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!