ID: 950717956_950717973

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 950717956 950717973
Species Human (GRCh38) Human (GRCh38)
Location 3:14863021-14863043 3:14863051-14863073
Sequence CCCTGATGTCCCCCACCCGCCTC CCTGCCTGGGCCAGGGCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 229} {0: 1, 1: 2, 2: 11, 3: 122, 4: 901}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!