ID: 950718761_950718767

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 950718761 950718767
Species Human (GRCh38) Human (GRCh38)
Location 3:14867870-14867892 3:14867895-14867917
Sequence CCAGGGAAGGTGTGATTGAGGAG GTCACCCTGTGGGCCCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 265} {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!