ID: 950729766_950729775

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950729766 950729775
Species Human (GRCh38) Human (GRCh38)
Location 3:14947541-14947563 3:14947591-14947613
Sequence CCCCCGCCGCGGCGGCGAGGCTG GCCCTCCTCCTACCAGCGCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!