ID: 950742746_950742752

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 950742746 950742752
Species Human (GRCh38) Human (GRCh38)
Location 3:15063351-15063373 3:15063364-15063386
Sequence CCTTCCCATTGCCCCCAGCAGGT CCCAGCAGGTACCCAAAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 305} {0: 1, 1: 0, 2: 1, 3: 21, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!