ID: 950761762_950761768

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 950761762 950761768
Species Human (GRCh38) Human (GRCh38)
Location 3:15236143-15236165 3:15236180-15236202
Sequence CCTGAGTGATAGAGACCCTGTCT TTGTGAAAGGGGAAGAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 364, 3: 979, 4: 1704} {0: 1, 1: 0, 2: 6, 3: 69, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!