ID: 950787793_950787801

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 950787793 950787801
Species Human (GRCh38) Human (GRCh38)
Location 3:15450361-15450383 3:15450410-15450432
Sequence CCTGCTGAGTCCCCAAGACACAG CCCAAGGGTGTCCCTCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 250} {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!