ID: 950892360_950892364

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 950892360 950892364
Species Human (GRCh38) Human (GRCh38)
Location 3:16415250-16415272 3:16415278-16415300
Sequence CCTTAGCAACTGGGAGAATGGAT TGCCAGAACTATCATGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 272} {0: 1, 1: 1, 2: 1, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!