ID: 950893732_950893733

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 950893732 950893733
Species Human (GRCh38) Human (GRCh38)
Location 3:16428701-16428723 3:16428717-16428739
Sequence CCATGTGTGTACAACGACAATTC ACAATTCAACAGCTGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54} {0: 2, 1: 0, 2: 5, 3: 34, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!