ID: 950896856_950896862

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 950896856 950896862
Species Human (GRCh38) Human (GRCh38)
Location 3:16460551-16460573 3:16460568-16460590
Sequence CCAAAACCAAAACCTCACATTTC CATTTCAAGCAGAGGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 48, 4: 429} {0: 1, 1: 0, 2: 1, 3: 32, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!