|
Left Crispr |
Right Crispr |
| Crispr ID |
950910980 |
950910987 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:16591539-16591561
|
3:16591555-16591577
|
| Sequence |
CCTACCTCAGCCTCCCTCTGAAG |
TCTGAAGTAGCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 25, 3: 274, 4: 2128} |
{0: 146, 1: 3945, 2: 60424, 3: 225200, 4: 284051} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|