ID: 950941590_950941596

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 950941590 950941596
Species Human (GRCh38) Human (GRCh38)
Location 3:16898458-16898480 3:16898482-16898504
Sequence CCTTTTGTCCTAAGGAATAGCTG CGGGTATGAATGCTACCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178} {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!