ID: 950944532_950944540

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950944532 950944540
Species Human (GRCh38) Human (GRCh38)
Location 3:16931014-16931036 3:16931067-16931089
Sequence CCAATGCCTTCTGCTTGGAAGAT CAGCCCAAATACTACATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 284} {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!