ID: 950949850_950949862

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950949850 950949862
Species Human (GRCh38) Human (GRCh38)
Location 3:16986688-16986710 3:16986741-16986763
Sequence CCATCTCACCTGGCCCCCTAGGG AACTGCTTTTAAAACTCTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 275} {0: 1, 1: 0, 2: 5, 3: 43, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!