ID: 950999997_951000002

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950999997 951000002
Species Human (GRCh38) Human (GRCh38)
Location 3:17547034-17547056 3:17547087-17547109
Sequence CCAATCAGTAGCAGATCTAGGTG CAAAACAAAACAAAAACAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87} {0: 1, 1: 34, 2: 204, 3: 1122, 4: 6987}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!