ID: 951016250_951016256

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 951016250 951016256
Species Human (GRCh38) Human (GRCh38)
Location 3:17735764-17735786 3:17735811-17735833
Sequence CCCTGCTGGATCTGGAGGGGTGG CAGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 16, 1: 50, 2: 105, 3: 152, 4: 348} {0: 29, 1: 90, 2: 112, 3: 84, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!