ID: 951080185_951080199

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 951080185 951080199
Species Human (GRCh38) Human (GRCh38)
Location 3:18444208-18444230 3:18444253-18444275
Sequence CCTTTTCCCCATTTGCTTCCTTC TTTTCTAAAAGGGGCCATACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 121, 4: 1105} {0: 1, 1: 0, 2: 0, 3: 19, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!