ID: 951210261_951210266

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 951210261 951210266
Species Human (GRCh38) Human (GRCh38)
Location 3:19966917-19966939 3:19966936-19966958
Sequence CCTGTACCTCCCAAGTAGTCCAG CCAGCGCATACCCCCATGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192} {0: 1, 1: 1, 2: 10, 3: 263, 4: 3250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!