ID: 951356822_951356825

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 951356822 951356825
Species Human (GRCh38) Human (GRCh38)
Location 3:21677338-21677360 3:21677358-21677380
Sequence CCTCTTGTGAATTGCAGCCTAAA AAATATACAAATCTGGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 130} {0: 1, 1: 0, 2: 3, 3: 35, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!