ID: 951381876_951381880

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 951381876 951381880
Species Human (GRCh38) Human (GRCh38)
Location 3:21994959-21994981 3:21994979-21995001
Sequence CCCTCAGATGGCATACATGTGCA GCAGTGATGTTAGTGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 106} {0: 1, 1: 0, 2: 12, 3: 65, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!