|
Left Crispr |
Right Crispr |
Crispr ID |
951544929 |
951544936 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:23815223-23815245
|
3:23815238-23815260
|
Sequence |
CCACCCACTTTGCCCTTCCAGAG |
TTCCAGAGTGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 9, 2: 199, 3: 3838, 4: 33650} |
{0: 316, 1: 17802, 2: 310705, 3: 259932, 4: 145685} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|