ID: 951544929_951544936

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 951544929 951544936
Species Human (GRCh38) Human (GRCh38)
Location 3:23815223-23815245 3:23815238-23815260
Sequence CCACCCACTTTGCCCTTCCAGAG TTCCAGAGTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 199, 3: 3838, 4: 33650} {0: 316, 1: 17802, 2: 310705, 3: 259932, 4: 145685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!