ID: 951549404_951549409

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 951549404 951549409
Species Human (GRCh38) Human (GRCh38)
Location 3:23861899-23861921 3:23861922-23861944
Sequence CCAAAGCCAGGATACAGAAAGCC CTCTGTCCTTGCCATAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217} {0: 8, 1: 40, 2: 87, 3: 103, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!