ID: 951558718_951558731

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 951558718 951558731
Species Human (GRCh38) Human (GRCh38)
Location 3:23945566-23945588 3:23945608-23945630
Sequence CCGCGAGGGCACCATGGAGGTGA TGCGGCGGGTGGGGGATGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144} {0: 1, 1: 0, 2: 5, 3: 58, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!