ID: 951594596_951594598

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 951594596 951594598
Species Human (GRCh38) Human (GRCh38)
Location 3:24303584-24303606 3:24303629-24303651
Sequence CCCACTGTGAGCTACACATGTTA TGATAGTTATGCAACATTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 80, 4: 530} {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!