ID: 951599359_951599370

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 951599359 951599370
Species Human (GRCh38) Human (GRCh38)
Location 3:24356262-24356284 3:24356312-24356334
Sequence CCCCAAAACTCCAGGTGGTCCTG TCCTAGACCCAAGACTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 23, 4: 202} {0: 1, 1: 0, 2: 0, 3: 10, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!