ID: 951690877_951690879

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 951690877 951690879
Species Human (GRCh38) Human (GRCh38)
Location 3:25395533-25395555 3:25395561-25395583
Sequence CCAATTATTCATAGGTTTGGTTG CATAATCCTACATTTCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 73, 2: 214, 3: 434, 4: 978} {0: 1, 1: 31, 2: 550, 3: 7267, 4: 3637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!